cdc73

Ensembl ID:
ENSDARG00000020201
ZFIN ID:
ZDB-GENE-040426-1309
Description:
parafibromin [Source:RefSeq peptide;Acc:NP_956642]
Human Orthologue:
CDC73
Human Description:
cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) [Source:HG
Mouse Orthologue:
Cdc73
Mouse Description:
cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene [Sour

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15197 Essential Splice Site Available for shipment Available now
sa17847 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013607 Essential Splice Site 103 521 3 16
Genomic Location (Zv9):
Chromosome 2 (position 11751806)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12176902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGACCCGACAGAAAAGAYTTGYTGTCTTATCTAAATGGAGAAAGCTG[T/G]AAGTGTGAAAAGCAAATCAGTCATTACAGAATTCAAGCTCAATCATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013607 Splice Site, Nonsense 473 521 16 16
Genomic Location (Zv9):
Chromosome 2 (position 11789229)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12214325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWTACWGAGGATATAGTGAGYTTCATGCCATGTTTATGCGTKTTTAGTT[C/T]GAGCCTTTCACCTGAAGTACGATGAGGCACGGATGGACCCAAACGTGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link