cdc73

Ensembl ID:
ENSDARG00000020201
ZFIN ID:
ZDB-GENE-040426-1309
Description:
parafibromin [Source:RefSeq peptide;Acc:NP_956642]
Human Orthologue:
CDC73
Human Description:
cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) [Source:HG
Mouse Orthologue:
Cdc73
Mouse Description:
cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene [Sour

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15197 Essential Splice Site Available for shipment Available now
sa5125 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17847 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013607 Essential Splice Site 103 521 3 16
Genomic Location:
Chromosome 2 (position 11751806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGACCCGACAGAAAAGAYTTGYTGTCTTATCTAAATGGAGAAAGCTG[T/G]AAGTGTGAAAAGCAAATCAGTCATTACAGAATTCAAGCTCAATCATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013607 Essential Splice Site 123 521 4 16
Genomic Location:
Chromosome 2 (position 11751963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCGACAGAAGTGCACCTATAGAGATAGGTCTACAAAGGCCAACACAAG[G/A]TATGTGAATTTGTGTGTTTTTGTTACAGGAAATCATTATCATGAATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013607 Splice Site, Nonsense 473 521 16 16
Genomic Location:
Chromosome 2 (position 11789229)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWTACWGAGGATATAGTGAGYTTCATGCCATGTTTATGCGTKTTTAGTT[C/T]GAGCCTTTCACCTGAAGTACGATGAGGCACGGATGGACCCAAACGTGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b76z534v