ppef1

Ensembl ID:
ENSDARG00000020191
ZFIN ID:
ZDB-GENE-080303-27
Description:
serine/threonine-protein phosphatase with EF-hands 1 [Source:RefSeq peptide;Acc:NP_001108202]
Human Orthologue:
PPEF1
Human Description:
protein phosphatase, EF-hand calcium binding domain 1 [Source:HGNC Symbol;Acc:9243]
Mouse Orthologue:
Ppef1
Mouse Description:
protein phosphatase with EF hand calcium-binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1097157]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41868 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35112 Nonsense Available for shipment Available now
sa15831 Nonsense Available for shipment Available now
sa35113 Nonsense Mutation detected in F1 DNA During 2017
sa14952 Nonsense Available for shipment Available now
sa35114 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003475 Essential Splice Site 19 718 3 19
Genomic Location (Zv9):
Chromosome 11 (position 31130541)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30007903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGCACATCCATTGCCATTGAGAACCAAACACGACCCTCAGAAACAGG[T/A]AAAATAAAAAATAATATCCCCAATTTTGTAACACACAGTAGCATAACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003475 Nonsense 33 718 4 19
Genomic Location (Zv9):
Chromosome 11 (position 31133366)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30010728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTAGCCATAAAAGCTGCCATACTGATCCAGCGTTGGTACAGACGCTA[T/A]GTTGCTCACCTGGAGATGCGAAGACGCTACACGTGGAACATCTTTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003475 Nonsense 70 718 5 19
Genomic Location (Zv9):
Chromosome 11 (position 31133602)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30010964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTTTGCAAATGTTTCCTTTCTAGCTCTCAAGTTTCTTCACTTTCATGT[T/A]GGAYAACTTCACTCAGATKAATGGGAATGGACCAGGTAATAAAATGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003475 Nonsense 360 718 12 19
Genomic Location (Zv9):
Chromosome 11 (position 31147348)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30024710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCTCAAGCCGACACTCGTCCCGCAGCAGAAGGAAGAAGCTCAGCAAG[C/T]AGGGCAGCCGCTCCTCCTCTTCCTCATCCTCCTCATCCTCCTCTTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003475 Nonsense 506 718 14 19
Genomic Location (Zv9):
Chromosome 11 (position 31150723)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30028085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTCTCTGCAWCAAACTACTATGAAGAGGGCAGTAACCGYGGGGCTTA[T/A]GTCARACTGGGGCCTGAACTTGTCCCTCGCTTCTTCCAGTATCAARTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003475 Nonsense 556 718 15 19
Genomic Location (Zv9):
Chromosome 11 (position 31151620)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30028982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTTCTGCACTCAGGGCTCTGAAAGAGAAACTTTATGCTCATCGCTCT[G/T]AACTCATGGCTGCCTTTCAACAGTATGACATCAATAACACAGGTTATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link