efnb2a

Ensembl ID:
ENSDARG00000020164
ZFIN ID:
ZDB-GENE-990415-67
Description:
Ephrin-B2a [Source:UniProtKB/Swiss-Prot;Acc:O73874]
Human Orthologue:
EFNB2
Human Description:
ephrin-B2 [Source:HGNC Symbol;Acc:3227]
Mouse Orthologue:
Efnb2
Mouse Description:
ephrin B2 Gene [Source:MGI Symbol;Acc:MGI:105097]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3393 Nonsense Confirmed mutation in F2 line Unknown
sa13177 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3393
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026011 Nonsense 86 332 2 5

The following transcripts of ENSDARG00000020164 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 27145028)
KASP Assay ID:
1083-0001.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAGTATTATAAACTCTATATGGTTCCTCTGGAACAGCTAAAGTCCTG[T/A]CAGGTCACAAAAGCAGACACGCCTCTACTCAACTGCGTCAAGCCAGACCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026011 Nonsense 210 332 5 5

The following transcripts of ENSDARG00000020164 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 27156680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTNNCCCTCTCTTAGATGCATCTCCTCATGGGGAAGAYAAGGGAGAT[G/T]GAAATAAATYCTCATCAGTCATTGGCTCAGAGGTGGCCCTGTTTGCCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oyascm6r