si:ch211-205h19.1

Ensembl ID:
ENSDARG00000020149
ZFIN ID:
ZDB-GENE-081107-18
Description:
Novel protein similar to H.sapiens ACOXL, acyl-Coenzyme A oxidase-like (ACOXL) [Source:UniProtKB/TrE
Human Orthologue:
ACOXL
Human Description:
acyl-CoA oxidase-like [Source:HGNC Symbol;Acc:25621]
Mouse Orthologue:
Acoxl
Mouse Description:
acyl-Coenzyme A oxidase-like Gene [Source:MGI Symbol;Acc:MGI:1921371]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14022 Essential Splice Site Available for shipment Available now
sa13812 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006547 Essential Splice Site 166 652 5 19
ENSDART00000131239 Essential Splice Site 185 628 5 19
Genomic Location (Zv9):
Chromosome 13 (position 48011162)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47262148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACGTTCGAGGCATTATCACCGAGGCCCGATATGATCAGSCCACACAGG[T/C]AYATCCAAAGTCTWCTTACTATATGTGTGACTATAGGAGAGCAGCTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006547 Nonsense 491 652 15 19
ENSDART00000131239 Nonsense 510 628 15 19
Genomic Location (Zv9):
Chromosome 13 (position 47948108)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 47199094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGTGGACAAAGTAGGAGACCTAATGTTCYTGCTGAAAGCGGTGCGCTA[C/A]AGGGAAAGGGTGTTACAGCGCAGTCTAGCGAGTCGACTCTACACTAAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link