fnbp1l

Ensembl ID:
ENSDARG00000020131
ZFIN ID:
ZDB-GENE-040801-155
Description:
formin-binding protein 1-like [Source:RefSeq peptide;Acc:NP_001003634]
Human Orthologue:
FNBP1L
Human Description:
formin binding protein 1-like [Source:HGNC Symbol;Acc:20851]
Mouse Orthologue:
Fnbp1l
Mouse Description:
formin binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1925642]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34354 Nonsense Mutation detected in F1 DNA During 2016
sa41155 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34355 Nonsense Mutation detected in F1 DNA During 2016
sa5472 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045038 Nonsense 124 548 5 14

The following transcripts of ENSDARG00000020131 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 15573727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGATCAACAGCATCTTCAGGAGGGACGGAAGGCCCAGCAGTA[T/A]CTAGACCAGTGCTGGAAACACATGGACAATGTGAGTCATTTTAGCGTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045038 Essential Splice Site 169 548 6 14

The following transcripts of ENSDARG00000020131 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 15578833)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGAGGTTAGACAATGACATCAACGCCACAAAGTCAGAAGTCGAAAAG[G/A]TATTCCTGTTCTTCACTTGAATTCTTACAGTTATTGACTGAATCTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045038 Nonsense 343 548 10 14

The following transcripts of ENSDARG00000020131 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 15587171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTACAGGCGCCAACACTAGAGGATCTCAGCCACCTTCCCCCTGAA[C/T]AGAGACGCAAAAAACTACAACAGCGGATCGATGAGCTGAATAAAGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045038 Essential Splice Site 442 548 None 14

The following transcripts of ENSDARG00000020131 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 15589275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGTCCAGTGCAGATGTAAACCATCACGCTCCGCACGGAAGAGAGAGG[T/A]CTGGGTTTCCTCACTACATTATCTGCATTCTCAACACAGATGGCCTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link