fnbp1l

Ensembl ID:
ENSDARG00000020131
ZFIN ID:
ZDB-GENE-040801-155
Description:
formin-binding protein 1-like [Source:RefSeq peptide;Acc:NP_001003634]
Human Orthologue:
FNBP1L
Human Description:
formin binding protein 1-like [Source:HGNC Symbol;Acc:20851]
Mouse Orthologue:
Fnbp1l
Mouse Description:
formin binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1925642]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5472 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045038 Essential Splice Site 442 548 None 14

The following transcripts of ENSDARG00000020131 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 15589275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGTCCAGTGCAGATGTAAACCATCACGCTCCGCACGGAAGAGAGAGG[T/A]CTGGGTTTCCTCACTACATTATCTGCATTCTCAACACAGATGGCCTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/isur1uww