LOC568800

Ensembl ID:
ENSDARG00000020128
Human Orthologue:
RAB31
Human Description:
RAB31, member RAS oncogene family [Source:HGNC Symbol;Acc:9771]
Mouse Orthologue:
Rab31
Mouse Description:
RAB31, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1914603]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19902 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024629 Nonsense 10 195 1 7
Genomic Location:
Chromosome 2 (position 53432600)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCTGCCTTAGCGTGCTCAACCATGGCCATAAGGGAGCTAAAAGTTTG[T/A]CTGCTCGGGGTGAGTGCTGAGGTTCCTCTGTCTGCGGCTTCACCGACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h3y5ru3a