sars2

Ensembl ID:
ENSDARG00000020115
ZFIN ID:
ZDB-GENE-040426-1616
Description:
seryl-tRNA synthetase, mitochondrial [Source:RefSeq peptide;Acc:NP_957473]
Human Orthologue:
FBXO17
Human Description:
F-box protein 17 [Source:HGNC Symbol;Acc:18754]
Mouse Orthologue:
Sars2
Mouse Description:
seryl-aminoacyl-tRNA synthetase 2 Gene [Source:MGI Symbol;Acc:MGI:1919234]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39039 Nonsense Mutation detected in F1 DNA During 2017
sa42502 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39038 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39039
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027424 Nonsense 20 510 1 16
Genomic Location (Zv9):
Chromosome 15 (position 13554915)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14706796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCAAGGGTAGCTTCACGGGTTTGCTCTTTCTATCTGCTTTTGTCCT[C/A]GAGACACGGTGTCAGCAGTGGCTGCAGATGGTCCGGCCGGTCCTGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027424 Essential Splice Site 121 510 2 16
Genomic Location (Zv9):
Chromosome 15 (position 13554004)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14707707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGAAGGCAGAAAGCAAGTGGTCAGTTCTACAGTCCGTGAGCTTGTGG[T/C]AAGTGTACGCACACATTGGTAACACTTTACAATAAGGTTGTATTAGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027424 Essential Splice Site 472 510 15 16
Genomic Location (Zv9):
Chromosome 15 (position 13531193)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14730518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTATTCCACGTACCATCATTGCTATTTTGGAGACATACCAAACCAAGG[T/C]ACCATTTAGAGAAAACTTGTATGAAACGCTTTTTTTATTGCCAATGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link