usp2a

Ensembl ID:
ENSDARG00000020107
ZFIN ID:
ZDB-GENE-041212-59
Description:
ubiquitin carboxyl-terminal hydrolase 2 [Source:RefSeq peptide;Acc:NP_001008574]
Human Orthologue:
USP2
Human Description:
ubiquitin specific peptidase 2 [Source:HGNC Symbol;Acc:12618]
Mouse Orthologue:
Usp2
Mouse Description:
ubiquitin specific peptidase 2 Gene [Source:MGI Symbol;Acc:MGI:1858178]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8592 Nonsense Mutation detected in F1 DNA During 2014
sa14898 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018185 None None 391 None 12
ENSDART00000123148 Nonsense 110 600 1 15
ENSDART00000134053 None None 394 None 12
Genomic Location:
Chromosome 15 (position 19887018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACTCCAGTAAAGGGCTATGGCTCAGGCCTGAATGGGGGCTCCGGATA[C/A]AGCAGCTACAGCTACACTCCGGCCCCCAGCAGCTACCTCTCCTCCTCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018185 Essential Splice Site 182 391 5 12
ENSDART00000123148 Essential Splice Site 392 600 8 15
ENSDART00000134053 Essential Splice Site 185 394 5 12
Genomic Location:
Chromosome 15 (position 19869570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTCACRGTCCGGCCACGRGGAAACACAGAAGATTTTGACCACTTGCC[G/A]TAAGTGTRCTATACTTATTTTCCTCCATATANNNNNNNNTATGCAAGATTTTATGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7qjllp03