calrl

Ensembl ID:
ENSDARG00000020103
ZFIN ID:
ZDB-GENE-030131-9907
Description:
calreticulin like [Source:RefSeq peptide;Acc:NP_958873]
Human Orthologue:
CALR
Human Description:
calreticulin [Source:HGNC Symbol;Acc:1455]
Mouse Orthologue:
Calr
Mouse Description:
calreticulin Gene [Source:MGI Symbol;Acc:MGI:88252]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19907 Nonsense Mutation detected in F1 DNA During 2016
sa25938 Nonsense Mutation detected in F1 DNA During 2016
sa38361 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025570 Nonsense 90 417 3 9
Genomic Location:
Chromosome 2 (position 55844059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGTTTCTACGCCACCTCTGTCCGCTTCGAGCCCTTTAGCAATGAGGGC[A/T]AAACACTGGTGATCCAGTTTACGGTTAAACACGAGCAGAAGATCGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025570 Nonsense 102 417 3 9
Genomic Location:
Chromosome 2 (position 55844095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCAATGAGGGCAAAACACTGGTGATCCAGTTTACGGTTAAACACGAG[C/T]AGAAGATCGACTGTGGAGGCGGATACGTTAAAGTCTTCCCAGCTGATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025570 Essential Splice Site 273 417 6 9
Genomic Location:
Chromosome 2 (position 55849455)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGGATGGAGAGTGGGAGCCTGCCATGATCCCTAACCCCGAGTACAAGG[T/A]ACAGATTCACATGCTATTCACACGCTACTAAAAAGTAAAAGTAAATTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link