kctd16b

Ensembl ID:
ENSDARG00000020102
ZFIN ID:
ZDB-GENE-060117-2
Description:
BTB/POZ domain-containing protein KCTD16 [Source:RefSeq peptide;Acc:NP_001122224]
Human Orthologue:
KCTD16
Human Description:
potassium channel tetramerisation domain containing 16 [Source:HGNC Symbol;Acc:29244]
Mouse Orthologue:
Kctd16
Mouse Description:
potassium channel tetramerisation domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:1914659]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1328 Nonsense Available for shipment Available now
sa3118 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022976 Nonsense 54 446 1 2
ENSDART00000126585 Nonsense 31 423 1 2
Genomic Location:
Chromosome 21 (position 39593182)
KASP Assay ID:
554-1242.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGATGTTATTGAATTAAACGTGGGGGGACAAGTCTATTATACACGTTA[T/A]ACTACGTTAATCAATACCCCTGGCTCTCTTTTGGGAAAAATATTCTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3118
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022976 Nonsense 407 446 2 2
ENSDART00000126585 Nonsense 384 423 2 2
Genomic Location:
Chromosome 21 (position 39608067)
KASP Assay ID:
554-2796.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTTCCCGAGACACTAGCACCTGCAAGAAACGGCCAGCAAAAGAAAAGT[T/A]GTCTGTGGAAGAGGAGCTGGAGAAGTGCATCCAGGACTTTCGCAAGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r6vv4789