tg

Ensembl ID:
ENSDARG00000020084
ZFIN ID:
ZDB-GENE-030519-1
Description:
Thyroglobulin [Source:UniProtKB/TrEMBL;Acc:Q2VA53]
Human Orthologue:
TG
Human Description:
thyroglobulin [Source:HGNC Symbol;Acc:11764]
Mouse Orthologue:
Tg
Mouse Description:
thyroglobulin Gene [Source:MGI Symbol;Acc:MGI:98733]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12312 Nonsense Available for shipment Available now
sa14597 Nonsense Available for shipment Available now
sa13796 Nonsense Available for shipment Available now
sa16248 Nonsense Available for shipment Available now
sa22880 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016386 Nonsense 140 2733 4 48
ENSDART00000136880 None None 837 None 18
ENSDART00000137113 None None 134 None 4
Genomic Location:
Chromosome 16 (position 33896747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGTGAGTACCAGCAGGTACAGTGTGAWGCGTCTMGCAGCCAGTGCTG[G/A]TGCGTYGACCTAGAGGGCATGGAGATCTATGGAACCAGGCAGAAHGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016386 Nonsense 523 2733 9 48
ENSDART00000136880 None None 837 None 18
ENSDART00000137113 None None 134 None 4
Genomic Location:
Chromosome 16 (position 33887505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGTTGGCTAAGACCTTCACAGACAGCTYTGAAAATCTTAATCTAGAC[C/T]AGGAGATCTCTGATGCGTTTGGTCGAYCGGTAAACCTGAAAAACAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016386 Nonsense 845 2733 10 48
ENSDART00000136880 None None 837 None 18
ENSDART00000137113 None None 134 None 4
Genomic Location:
Chromosome 16 (position 33884612)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGATCTGTTAGACGGGAACAGTGAAGCGGTTTATGGACCATCAGTTTA[C/A]TTRAACCCATTATCCTTATGGCGACTAATCAGATTAGATGATTCTGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016386 Nonsense 1906 2733 31 48
ENSDART00000136880 Nonsense 10 837 1 18
ENSDART00000137113 None None 134 None 4
Genomic Location:
Chromosome 16 (position 33863727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATATCCTGACACACGTGTGTGCGGAGCWTATGACAAACCTCTCAGA[C/T]AGACATGCAGTTTAGTGATGACACAGAGTCTGCAGACYGCATACCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016386 Nonsense 2213 2733 38 48
ENSDART00000136880 Nonsense 317 837 8 18
ENSDART00000137113 None None 134 None 4
Genomic Location:
Chromosome 16 (position 33856002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCCCTTATGCTCGTCCACCAATCGGAGACCTCAGATTCAGCCCCCCA[C/T]AGCCTGCTGACTGGACCGGGACCTGGAACGCCACATTTTCCCGGTGAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rs5tj4zr