ek1

Ensembl ID:
ENSDARG00000020080
ZFIN ID:
ZDB-GENE-990415-58
Description:
Ephrin type-A receptor 3 [Source:UniProtKB/Swiss-Prot;Acc:O13146]
Human Orthologue:
EPHA4
Human Description:
EPH receptor A4 [Source:HGNC Symbol;Acc:3388]
Mouse Orthologue:
Epha4
Mouse Description:
Eph receptor A4 Gene [Source:MGI Symbol;Acc:MGI:98277]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4292 Nonsense Mutation detected in F1 DNA During 2014
sa24519 Nonsense Mutation detected in F1 DNA During 2014
sa8415 Nonsense Mutation detected in F1 DNA During 2014
sa8869 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 89 981 3 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 28442802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTAATGGAAGCCAATCAGAACAACTGGTTGCGYACTGGACTGATTCAA[C/T]GAGAAGGTGCTCAGCGCGTCTATGTGGAGATCAAATTTACTCTGCRTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 157 981 3 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 28443006)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACCAGTACATCAAGATCGACACTATAGCAGCTGACGAGAGCTTCACA[C/T]AGACAGACGTTGGGGATCGTGTGATGAAGTTAAACACAGAAGTACGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 689 981 11 17
ENSDART00000105774 Nonsense 689 981 11 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 28547973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGAGYGAGGCCAGCATTATGGGCCAGYTYGACCACCCTAACATCATT[C/T]GACTGGAAGGAGTTGTCACCAGATGTAAGCGTTTATATCCCAKTCACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 689 981 11 17
ENSDART00000105774 Nonsense 689 981 11 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 28547973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGAGYGAGGCCAGCATTATGGGCCAGYTYGACCACCCTAACATCATT[C/T]GACTGGAAGGAGTTGTCACCAGATGTAAGCGTTTATATCCCAKTCACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Brain imaging: Whole genome association study of brain-wide imaging phenotypes for identifying quantitative trait loci in MCI and AD: A study of the ADNI cohort. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ss2zsgil