neil3

Ensembl ID:
ENSDARG00000020079
ZFIN ID:
ZDB-GENE-041114-18
Description:
endonuclease VIII-like 3 [Source:RefSeq peptide;Acc:NP_001007336]
Human Orthologue:
NEIL3
Human Description:
nei endonuclease VIII-like 3 (E. coli) [Source:HGNC Symbol;Acc:24573]
Mouse Orthologue:
Neil3
Mouse Description:
nei like 3 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:2384588]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35732 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015761 Nonsense 554 568 10 10
ENSDART00000123343 Nonsense 563 577 10 10

The following transcripts of ENSDARG00000020079 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37648601)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36087928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACTTCTACACATGCCCAGTTAAAATGGGCAAGCAGTGTAACTTCTTT[C/T]AGTGGGCTGAAAATGGCCCTGGCATCTCAATTCTGCCTGGCTGCTGAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link