nol10

Ensembl ID:
ENSDARG00000020077
ZFIN IDs:
ZDB-GENE-040426-764, ZDB-GENE-040426-764
Description:
Nucleolar protein 10 [Source:UniProtKB/Swiss-Prot;Acc:Q802W4]
Human Orthologue:
NOL10
Human Description:
nucleolar protein 10 [Source:HGNC Symbol;Acc:25862]
Mouse Orthologue:
Nol10
Mouse Description:
nucleolar protein 10 Gene [Source:MGI Symbol;Acc:MGI:2684913]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43016 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004379 Nonsense 437 722 16 21
ENSDART00000121787 Nonsense 437 722 16 22
Genomic Location (Zv9):
Chromosome 17 (position 52234906)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51619561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACGAGGAGTACCGCAAAGACAAGATCAGACAGAAGATCGAGGAATCC[A/T]GAGCTCAGAGAGTCCAGCTGAAGGTGCGTTGAAGAAAGAGGACATTTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link