thbs4b

Ensembl ID:
ENSDARG00000020072
ZFIN ID:
ZDB-GENE-020708-4
Description:
Thrombospondin-4-B [Source:UniProtKB/Swiss-Prot;Acc:Q8JGW0]
Human Orthologue:
THBS4
Human Description:
thrombospondin 4 [Source:HGNC Symbol;Acc:11788]
Mouse Orthologue:
Thbs4
Mouse Description:
thrombospondin 4 Gene [Source:MGI Symbol;Acc:MGI:1101779]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37222 Nonsense Mutation detected in F1 DNA During 2016
sa32331 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37223 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3141 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102572 Nonsense 30 949 2 22

The following transcripts of ENSDARG00000020072 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 5375911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCTTATATAACCTTTAAATACATTTTCCCCCTCAGTGTATAACCTCT[T/G]AACGTCACCGGACTGTCTACCGGATCTACTGCATGGTGGTTTGGCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102572 Essential Splice Site 220 949 5 22

The following transcripts of ENSDARG00000020072 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 5384560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGTTTGTCTGTTAAAATGATTAAATTTGGCTTTTTTGTTGTTTGTAA[A/G]GGGCTTAACACGAAACAGCTTACAACTCAGATGCTGGAGCTAACAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102572 Essential Splice Site 473 949 11 22

The following transcripts of ENSDARG00000020072 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 5394827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTACCCTGATGAGAGGCTGCGCTGCCGAGACCCAACCTGCAGAAAGG[T/A]AACCATGGCAACAGTGCAATCGATATTGACTAGCTTAGGGCTTTGGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102572 Essential Splice Site 510 949 13 22

The following transcripts of ENSDARG00000020072 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 5395166)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTAGTTATGAAGCAAATAAAGACCAKATCTTGTTCCTGTGTRTACTGT[A/T]GGATAACTGCTGGTTGACGCCAAATATAAATCAGCAGAATAGTGATAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link