bmpr2b

Ensembl ID:
ENSDARG00000020057
ZFIN ID:
ZDB-GENE-070618-2
Description:
bone morphogenetic protein receptor type-2 [Source:RefSeq peptide;Acc:NP_001034896]
Human Orthologue:
BMPR2
Human Description:
bone morphogenetic protein receptor, type II (serine/threonine kinase) [Source:HGNC Symbol;Acc:1078]
Mouse Orthologue:
Bmpr2
Mouse Description:
bone morphogenic protein receptor, type II (serine/threonine kinase) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41374 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34578 Nonsense Mutation detected in F1 DNA During 2017
sa41375 Nonsense Mutation detected in F1 DNA During 2017
sa5781 Nonsense F2 line generated During 2017
sa2507 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa41374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Essential Splice Site 147 1071 3 13
ENSDART00000125961 Essential Splice Site 147 1071 3 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13310152)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13062717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCAACTTCACAGAGAACTGGGTGCCCAGTCCCACCAGCACTGCCAACC[G/A]TAAGTCCTACAAACGCAGCATCTCTAGACTTCATCTGAAAGCCCCATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Nonsense 516 1071 11 13
ENSDART00000125961 Nonsense 516 1071 11 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13381491)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13134056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGACAGCGCAGTGTGCAGAGGAGCGTATGGCAGAACTGCTGCTGATTT[G/A]GGAAAGGAACAAACCTGTCAGTCCCACCATCAATCCCATGAGCACAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Nonsense 773 1071 12 13
ENSDART00000125961 Nonsense 773 1071 12 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13383371)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13135936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAACAGCAGAATCTCCCCAAGAGGCCCACTAGCTTACCCCTCAACACC[A/T]AAAATCCTGGTAGGGAGTCTTCGTCGTCTCGATTGAAATTCGGGAAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5781
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Nonsense 1003 1071 13 13
ENSDART00000125961 Nonsense 1003 1071 13 13
ENSDART00000002334 Nonsense 1003 1071 13 13
ENSDART00000125961 Nonsense 1003 1071 13 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13387169)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13139734
KASP Assay ID:
554-3063.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAGAAGATTAAAAAACGTGTGAAGACWCCTTATTCGTTGAAAAGATG[G/A]CGTCCTTCCACATGGGTCGTCTCCACTGATACACTAGAYGGAGAGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2507
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Nonsense 1003 1071 13 13
ENSDART00000125961 Nonsense 1003 1071 13 13
ENSDART00000002334 Nonsense 1003 1071 13 13
ENSDART00000125961 Nonsense 1003 1071 13 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13387169)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13139734
KASP Assay ID:
554-3063.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAGAAGATTAAAAAACGTGTGAAGACWCCTTATTCGTTGAAAAGATG[G/A]CGTCCTTCCACATGGGTCGTCTCCACTGATACACTAGAYGGAGAGGTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link