aox1

Ensembl ID:
ENSDARG00000020054
ZFIN ID:
ZDB-GENE-050208-742
Description:
Novel protein similar to vertebrate aldehyde oxidase 1 (AOX1) [Source:UniProtKB/TrEMBL;Acc:Q1LVZ9]
Human Orthologue:
AOX1
Human Description:
aldehyde oxidase 1 [Source:HGNC Symbol;Acc:553]
Mouse Orthologues:
Aox1, Aox3, Aox3l1, Aox4
Mouse Descriptions:
aldehyde oxidase 1 Gene [Source:MGI Symbol;Acc:MGI:88035]
aldehyde oxidase 3 Gene [Source:MGI Symbol;Acc:MGI:1918974]
aldehyde oxidase 3-like 1 Gene [Source:MGI Symbol;Acc:MGI:3529596]
aldehyde oxidase 4 Gene [Source:MGI Symbol;Acc:MGI:1919122]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17377 Essential Splice Site Available for shipment Available now
sa17653 Nonsense Available for shipment Available now
sa24109 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24110 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043711 Essential Splice Site 37 1338 2 35
ENSDART00000105714 None None 754 None 19
ENSDART00000142548 Essential Splice Site 37 1313 2 34
Genomic Location:
Chromosome 22 (position 14196370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAACCCAGATCCTGAGACTATGCWTCTGCCCTATTTGAGGAAAAAAT[G/A]TATATTTTACATTATGCATATGCAAATACTACTAYTATTACTACTAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043711 Nonsense 129 1338 5 35
ENSDART00000105714 None None 754 None 19
ENSDART00000142548 Nonsense 128 1313 5 34
Genomic Location:
Chromosome 22 (position 14199273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGGTCTCAATGTGGCTTCTGTACTCCTGGGATGGTGATGTCCATGTA[T/A]ACATTGCTAAGAAACAACCCACATSCCACCTTGGATGACATAACAGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043711 Essential Splice Site 563 1338 16 35
ENSDART00000105714 None None 754 None 19
ENSDART00000142548 Essential Splice Site 562 1313 16 34
Genomic Location:
Chromosome 22 (position 14208905)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCAACCTCTTCCAAAACGCATTCTACCTGGTTATCAAGAATTTCAGG[T/C]AGTGTGATGTTAATGTTACTTAATTAGGAATTTATACCTGCTATACCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043711 Essential Splice Site 1317 1338 None 35
ENSDART00000105714 Missense 752 754 19 19
ENSDART00000142548 Missense 1311 1313 34 34
Genomic Location:
Chromosome 22 (position 14227488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCCAGAGCGGGCATGTCTAGCCTGCGCCACACGCTTCACAAACATGG[T/A]ACAACAATAAAAGTAGCCATTTCAGTGTCATGTTTAGAGTCCAAATATAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Intelligence: Genome-wide association study of intelligence: additive effects of novel brain expressed genes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yl3fq67x