nkd1

Ensembl ID:
ENSDARG00000020053
ZFIN ID:
ZDB-GENE-061108-3
Description:
Protein naked cuticle homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q2TJA6]
Human Orthologue:
NKD1
Human Description:
naked cuticle homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17045]
Mouse Orthologue:
Nkd1
Mouse Description:
naked cuticle 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2135954]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21012 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052379 Essential Splice Site 19 440 2 10
Genomic Location (Zv9):
Chromosome 7 (position 39014086)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37350726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCTCTTTTTAAAGCTGCTATCTGTAAAGCGAGGGAGAGTCCTGAAG[G/A]TGAGTTGAGTGTACTTTGTTATTCATCAAATAAATAATTCCGCTTCTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link