ahr1a

Ensembl ID:
ENSDARG00000020046
ZFIN ID:
ZDB-GENE-020531-2
Description:
aryl hydrocarbon receptor 1 [Source:RefSeq peptide;Acc:NP_571103]
Human Orthologue:
AHR
Human Description:
aryl hydrocarbon receptor [Source:HGNC Symbol;Acc:348]
Mouse Orthologue:
Ahr
Mouse Description:
aryl-hydrocarbon receptor Gene [Source:MGI Symbol;Acc:MGI:105043]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1410 Nonsense Available for shipment Available now
sa4653 Nonsense Mutation detected in F1 DNA During 2014
sa16655 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019024 Nonsense 179 807 5 11
ENSDART00000049830 Nonsense 180 808 6 12
ENSDART00000136461 Nonsense 162 790 5 10
Genomic Location:
Chromosome 16 (position 22111742)
KASP Assay ID:
554-1331.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTGTGTATGAACTCATTCATACTGAAGACCGGCATGAGTTTCAGAGA[C/T]AGCTCCRCTGGGCCCTCWACCCTGGCTTTACCCCAGACTCTAGACAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019024 Nonsense 320 807 8 11
ENSDART00000049830 Nonsense 321 808 9 12
ENSDART00000136461 Nonsense 303 790 8 10
Genomic Location:
Chromosome 16 (position 22106865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCCCRCAGTTGGAATTTTGTTCTTGGCTACACAGAGGCAGAGCTCTG[T/A]AAWAGTGGTTCAGGCTATCAGTTCATCCATGCAGCTGAYATGATGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019024 Essential Splice Site 391 807 9 11
ENSDART00000049830 Essential Splice Site 392 808 10 12
ENSDART00000136461 Essential Splice Site 374 790 9 10
Genomic Location:
Chromosome 16 (position 22105369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAAAATGGGCARCCAGATTGCATCATCACCTCKCACAGAGTCATAAC[G/A]TATGCACTTATTTTTGTCTTTGCTATTTATTTGGGKTTTTTTTTTNNTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9r967pn6