cnot8

Ensembl ID:
ENSDARG00000020043
ZFIN ID:
ZDB-GENE-040426-2845
Description:
CCR4-NOT transcription complex subunit 8 [Source:RefSeq peptide;Acc:NP_998644]
Human Orthologue:
CNOT8
Human Description:
CCR4-NOT transcription complex, subunit 8 [Source:HGNC Symbol;Acc:9207]
Mouse Orthologue:
Cnot8
Mouse Description:
CCR4-NOT transcription complex, subunit 8 Gene [Source:MGI Symbol;Acc:MGI:1916375]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24001 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018350 Nonsense 34 285 2 7
Genomic Location:
Chromosome 21 (position 35774121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAATGTGGAGGAGGAGATGAGGAAGATACGACAGATCATTCAGAACTA[C/A]AACTACATTGCCATGGTGTGTTTGTGTTTGCATTGATGGACCATCAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eg03hhl9