LOC100148094

Ensembl ID:
ENSDARG00000020039
Human Orthologue:
MAD2L1BP
Human Description:
MAD2L1 binding protein [Source:HGNC Symbol;Acc:21059]
Mouse Orthologue:
Mad2l1bp
Mouse Description:
MAD2L1 binding protein Gene [Source:MGI Symbol;Acc:MGI:1913841]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42246 Nonsense Mutation detected in F1 DNA During 2016
sa2699 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa42246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004779 Nonsense 123 385 2 3
Genomic Location:
Chromosome 13 (position 33923251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATATACTTACTAAATAATGGCACCGAAATGTTTTATTTCAAGGTTGT[C/T]AGGAGACTGATTCTTTGGCCAGTGCTTCTGGCAGTCATAAGGATTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2699
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004779 Nonsense 162 385 2 3
Genomic Location:
Chromosome 13 (position 33923134)
KASP Assay ID:
554-3018.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACTCTGTAGATGATGAAGAAATATTCAGAAGAGCGAGAGAGGAAGGA[C/T]GAGTGAATGTCATCTTCCCTGGATGCATCACTCAGGATGGTTGCTGTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link