cldn11a

Ensembl ID:
ENSDARG00000020031
ZFIN ID:
ZDB-GENE-040718-369
Description:
claudin-11 [Source:RefSeq peptide;Acc:NP_001002624]
Human Orthologue:
CLDN11
Human Description:
claudin 11 [Source:HGNC Symbol;Acc:8514]
Mouse Orthologue:
Cldn11
Mouse Description:
claudin 11 Gene [Source:MGI Symbol;Acc:MGI:106925]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19766 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010615 Nonsense 161 215 3 3
Genomic Location:
Chromosome 2 (position 26146238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCCATCACGAGAAGGGTCTGATGTCCTTTGGCTTTTCTCTGTATTCA[G/T]GATGGGTGGGGACAGCTCTCTGTCTGCTGGGAGGCTGTATAATCAGCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7p3536l0