bmp2k

Ensembl ID:
ENSDARG00000020009
ZFIN ID:
ZDB-GENE-041212-72
Description:
BMP-2-inducible protein kinase isoform 2 [Source:RefSeq peptide;Acc:NP_001008644]
Human Orthologues:
BMP2K, BMP2KL
Human Descriptions:
BMP2 inducible kinase [Source:HGNC Symbol;Acc:18041]
BMP2 inducible kinase-like [Source:HGNC Symbol;Acc:17080]
Mouse Orthologue:
Bmp2k
Mouse Description:
BMP2 inducible kinase Gene [Source:MGI Symbol;Acc:MGI:2155456]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6995 Nonsense Mutation detected in F1 DNA During 2016
sa40519 Nonsense Mutation detected in F1 DNA During 2016
sa12724 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006079 Nonsense 48 645 1 15
Genomic Location:
Chromosome 5 (position 40700366)
KASP Assay ID:
554-5144.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGTTTGCTGTCGGTCGATACCAAGTGACTGTGGAGGAGCTTATCGCT[G/T]AAGGTAAATGCATGCACTGGATTTAGGCCAAAGAAAAGATYATGGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006079 Nonsense 574 645 14 15
Genomic Location:
Chromosome 5 (position 40743055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGTCATGAGCCCCCCTCCACAGACCGTCAGCAACCCTCCTGATATGT[C/A]AAGCTGGAACCCCTTTGGAGAAGATAATTTCTCTAAACTCACCGAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006079 Essential Splice Site 603 645 14 15
Genomic Location:
Chromosome 5 (position 40743143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACCGAAGAGGAGCTTCTCRATCGAGAATTCGACCTTCTWAGAGCAAG[C/T]AAGTGTCTCTGTTTATTTCTGCACAACCTGACCANNCTCTCTCTCTCCTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link