bmp2k

Ensembl ID:
ENSDARG00000020009
ZFIN ID:
ZDB-GENE-041212-72
Description:
BMP-2-inducible protein kinase isoform 2 [Source:RefSeq peptide;Acc:NP_001008644]
Human Orthologues:
BMP2K, BMP2KL
Human Descriptions:
BMP2 inducible kinase [Source:HGNC Symbol;Acc:18041]
BMP2 inducible kinase-like [Source:HGNC Symbol;Acc:17080]
Mouse Orthologue:
Bmp2k
Mouse Description:
BMP2 inducible kinase Gene [Source:MGI Symbol;Acc:MGI:2155456]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6995 Nonsense Mutation detected in F1 DNA During 2014
sa12724 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006079 Nonsense 48 645 1 15
Genomic Location:
Chromosome 5 (position 40700366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGTTTGCTGTCGGTCGATACCAAGTGACTGTGGAGGAGCTTATCGCT[G/T]AAGGTAAATGCATGCACTGGATTTAGGCCAAAGAAAAGATYATGGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006079 Essential Splice Site 603 645 14 15
Genomic Location:
Chromosome 5 (position 40743143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACCGAAGAGGAGCTTCTCRATCGAGAATTCGACCTTCTWAGAGCAAG[C/T]AAGTGTCTCTGTTTATTTCTGCACAACCTGACCANNCTCTCTCTCTCCTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u4231a2x