col1a2

Ensembl ID:
ENSDARG00000020007
ZFIN ID:
ZDB-GENE-030131-8415
Description:
collagen alpha-2(I) chain [Source:RefSeq peptide;Acc:NP_892013]
Human Orthologue:
COL1A2
Human Description:
collagen, type I, alpha 2 [Source:HGNC Symbol;Acc:2198]
Mouse Orthologue:
Col1a2
Mouse Description:
collagen, type I, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88468]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1763 Essential Splice Site Available for shipment Available now
sa17981 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042990 None None 1352 None 50
ENSDART00000144544 Essential Splice Site 24 1352 2 50
Genomic Location:
Chromosome 19 (position 41945790)
KASP Assay ID:
554-1756.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTCTCTGTCTTTCTGTTTTCCTCCTCCACCCCATCGCCATCACACA[G/A]CGGTCAGTATCCAAGTTATTACACTAATAGAGATATTTACCTTATCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042990 Essential Splice Site 153 1352 10 50
ENSDART00000144544 Essential Splice Site 153 1352 10 50
Genomic Location:
Chromosome 19 (position 41948173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAGTAATATTTCTAACAAGGATCTTCATCNTTTTTTAATGTTTTCCAA[A/G]GGGTGCCCGTGGTTTCCCAGGAACTCCTGGACTTCCTGGCATGAAGGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cqsji1r4