sh3bp4a

Ensembl ID:
ENSDARG00000020000
ZFIN ID:
ZDB-GENE-040303-3
Description:
SH3 domain-binding protein 4-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LVQ2]
Human Orthologue:
SH3BP4
Human Description:
SH3-domain binding protein 4 [Source:HGNC Symbol;Acc:10826]
Mouse Orthologue:
Sh3bp4
Mouse Description:
SH3-domain binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:2138297]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13969 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022654 Nonsense 549 934 6 8
ENSDART00000080307 Nonsense 549 755 6 7
ENSDART00000105711 Nonsense 580 965 3 5
ENSDART00000130585 Nonsense 580 965 2 4
Genomic Location (Zv9):
Chromosome 22 (position 14064172)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 13895280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCAGATCAAACTAGGCAAGGTGAGCAGGCTCATCTACATGATTTCAT[C/A]ACGGAAAGCAGATGAGATTTCTGACTTCACGCTACGTGTCCAAGTAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link