grhprb

Ensembl ID:
ENSDARG00000019986
ZFIN ID:
ZDB-GENE-040426-1847
Description:
glyoxylate reductase/hydroxypyruvate reductase b [Source:RefSeq peptide;Acc:NP_991248]
Human Orthologue:
GRHPR
Human Description:
glyoxylate reductase/hydroxypyruvate reductase [Source:HGNC Symbol;Acc:4570]
Mouse Orthologue:
Grhpr
Mouse Description:
glyoxylate reductase/hydroxypyruvate reductase Gene [Source:MGI Symbol;Acc:MGI:1923488]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19472 Nonsense Mutation detected in F1 DNA During 2014
sa17209 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009457 Nonsense 8 336 1 9
ENSDART00000132958 Nonsense 33 361 1 9
ENSDART00000139314 Nonsense 33 228 1 6
ENSDART00000147502 Nonsense 33 351 1 9

The following transcripts of ENSDARG00000019986 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 18587128)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACCGTGACCGGACATCACCGCGCGATGTCCGCGTTACCGAAAGTGTA[T/A]GTGACCCGCAGGATTCCACCAGATGGACTGGACATTCTGCGAAAATCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009457 Nonsense 307 336 9 9
ENSDART00000132958 Nonsense 332 361 9 9
ENSDART00000139314 None None 228 None 6
ENSDART00000147502 Nonsense 322 351 9 9

The following transcripts of ENSDARG00000019986 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 18578978)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTMTGTTTGTATTTGCAGTGATTCTTCCTCACATTGCCAGTGCGTCCTA[T/A]ACCACACGAAACGCCATGTCWGCCCTCGCTGCCAACAACCTGCTGGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i3glo3pt