sfxn1

Ensembl ID:
ENSDARG00000019963
ZFIN ID:
ZDB-GENE-040801-45
Description:
sideroflexin-1 [Source:RefSeq peptide;Acc:NP_001003537]
Human Orthologue:
SFXN1
Human Description:
sideroflexin 1 [Source:HGNC Symbol;Acc:16085]
Mouse Orthologue:
Sfxn1
Mouse Description:
sideroflexin 1 Gene [Source:MGI Symbol;Acc:MGI:2137677]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35764 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023654 Nonsense 307 322 11 11
ENSDART00000111035 Nonsense 307 322 10 10
ENSDART00000133811 Nonsense 309 324 10 10
Genomic Location (Zv9):
Chromosome 14 (position 51338871)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50091587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCTCTATGGCAGTGAGCCGCCTGGAGCCGGAGTTGCAAGAGAAGATT[C/T]GAGCCAGTCATCCTGGAGTAGAGACGGTTTATTTCAACAAAGGACTGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link