dopey1

Ensembl ID:
ENSDARG00000019962
ZFIN ID:
ZDB-GENE-050309-65
Description:
Dopey1 protein [Source:UniProtKB/TrEMBL;Acc:Q5BLI9]
Human Orthologue:
DOPEY1
Human Description:
dopey family member 1 [Source:HGNC Symbol;Acc:21194]
Mouse Orthologue:
Dopey1
Mouse Description:
dopey family member 1 Gene [Source:MGI Symbol;Acc:MGI:1289294]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25024 Nonsense Mutation detected in F1 DNA During 2017
sa5625 Essential Splice Site F2 line generated During 2017
sa2859 Essential Splice Site F2 line generated During 2017
sa16205 Nonsense Available for shipment Available now
sa9700 Nonsense Available for shipment Available now
sa36196 Nonsense Mutation detected in F1 DNA During 2017
sa12398 Nonsense Available for shipment Available now
sa14239 Nonsense Available for shipment Available now
sa36195 Nonsense Mutation detected in F1 DNA During 2017
sa39117 Nonsense Mutation detected in F1 DNA During 2017
sa13013 Nonsense Available for shipment Available now
sa42769 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Nonsense 162 2477 3 37
Genomic Location (Zv9):
Chromosome 16 (position 35408187)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33140496
KASP Assay ID:
554-7851.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTCCTGACTGGGGTGCTACCTGGACTGGAAGAGGGCTCAGAGTATTA[T/A]GACAGGTAAAATGAAGGTTTTTAATCTAGAACTGATTCTAAAATGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5625
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Essential Splice Site 486 2477 11 37
ENSDART00000010778 Essential Splice Site 486 2477 11 37
Genomic Location (Zv9):
Chromosome 16 (position 35402461)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33134770
KASP Assay ID:
554-3053.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGAGTTTTGTGAGCTGGTGGACTTCTTGTWGGACATTGTGTCTTTGG[T/C]TGGTAAACATTGGATATGATGATTTATCTACTTAGSCTCATTTTCTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2859
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Essential Splice Site 486 2477 11 37
ENSDART00000010778 Essential Splice Site 486 2477 11 37
Genomic Location (Zv9):
Chromosome 16 (position 35402461)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33134770
KASP Assay ID:
554-3053.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGAGTTTTGTGAGCTGGTGGACTTCTTGTWGGACATTGTGTCTTTGG[T/C]TGGTAAACATTGGATATGATGATTTATCTACTTAGSCTCATTTTCTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Nonsense 725 2477 14 37
Genomic Location (Zv9):
Chromosome 16 (position 35395533)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33127842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGTCTTCTGAGCAGATGGAATGTCTTGCWGCGTTCACTGCTGCCTG[T/A]CAGCTCTTCCTGGAGTGTTCCAGTTTTCCGGTTTACATCGCTGAGGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Nonsense 1064 2477 19 37
Genomic Location (Zv9):
Chromosome 16 (position 35393702)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33126011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAGTCAACCCGTTGAGTGACAGTATTTCTCTCTTGAGYCTTAGCAGT[G/T]AGAACCTGCAGCTGTGTGGCGAATATCAACCACCTGATCAGCAGGGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Nonsense 1072 2477 19 37
Genomic Location (Zv9):
Chromosome 16 (position 35393676)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33125985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCTCTCTTGAGTCTTAGCAGTGAGAACCTGCAGCTGTGTGGCGAATA[T/A]CAACCACCTGATCAGCAGGGGGAGCCCAATAGCTCAGATTCGAGTGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Nonsense 1458 2477 19 37
Genomic Location (Zv9):
Chromosome 16 (position 35392518)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33124827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTCCGAAGTGCCATGTTCCTGGAGATCATAATCTCCCTTTGYCTCTA[T/A]TTTCTGCGCAGCTATTACTCAGCCCATGTGGCTGCCACGTCACAGGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Nonsense 1650 2477 19 37
Genomic Location (Zv9):
Chromosome 16 (position 35391944)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33124253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAACCCATGACTTCCCTGCAATACCTACATGGGCAGCCTATCACAGCA[C/T]AAGGCATGTTTYTATGTGCTGTAATTCGAGCTTTGCAWCAACAYCATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Nonsense 1845 2477 22 37
Genomic Location (Zv9):
Chromosome 16 (position 35390487)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33122796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCCGATCTCAATGAATCACGGAGCTCACTTTATGGCTGCTATTGCTTA[T/A]GTGTGGAATGAAAGGAAGCAGGTTAAAACTCCATCTAGAAACAAGGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Nonsense 2156 2477 31 37
Genomic Location (Zv9):
Chromosome 16 (position 35383680)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33115989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTTACAGCTGGAGAGCAATCATAGACCACCTGATGACTCATGAC[A/T]AAACCACATTCAGGGACCTAATGAGTGAGTCTTTCCTCTCTGCCAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Nonsense 2180 2477 32 37
Genomic Location (Zv9):
Chromosome 16 (position 35383514)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33115823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCCGAGTTGCTGTGGCTCAGAGCAGCTCTTTGAGTCTTTTCACCAAT[C/T]GAGATGCAGAGCTTGAGCAGAGAGCCATGCTACTCAAACGCCTGGCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010778 Essential Splice Site 2215 2477 32 37
Genomic Location (Zv9):
Chromosome 16 (position 35383407)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33115716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGCAGTGAGGTGGACCAGTACCAGAAGTACTTGCCAGACATCCAAGG[T/C]ACTCAAATCTGCTCATTTCAGTGGTGATGTCGAGTTAAATTGGAAGTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link