sec62

Ensembl ID:
ENSDARG00000019951
ZFIN ID:
ZDB-GENE-050913-83
Description:
translocation protein SEC62 [Source:RefSeq peptide;Acc:NP_001020701]
Human Orthologue:
SEC62
Human Description:
SEC62 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:11846]
Mouse Orthologue:
Sec62
Mouse Description:
SEC62 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1916526]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16739 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004626 Nonsense 81 394 3 8

The following transcripts of ENSDARG00000019951 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 36978603)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37275313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAGGGCGAAGAAGCTTTGWTCACAACCAGAGAGTCGGTGGTGGACTA[T/G]TGCAACAGGTAAATCTAGKCTCTTTCGTTTCTCTAGTGAACTAACGWTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link