als2cr8

Ensembl ID:
ENSDARG00000019950
ZFIN ID:
ZDB-GENE-070912-172
Description:
Novel protein similar to human amyotrophic lateral sclerosis 2 (Juvenile) chromosome region, candida
Human Orthologue:
ALS2CR8
Human Description:
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 [Source:HGNC Symbol;Acc:14
Mouse Orthologue:
Carf
Mouse Description:
calcium response factor Gene [Source:MGI Symbol;Acc:MGI:2182269]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21447 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18940 Nonsense Mutation detected in F1 DNA During 2014
sa9357 Nonsense Mutation detected in F1 DNA During 2014
sa3738 Nonsense Mutation detected in F1 DNA During 2014
sa15446 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Essential Splice Site 191 657 5 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Essential Splice Site 195 477 5 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 13510107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCCACCAGGGTCACCAAACTGGGCTCTCAGACTGCGCGGGTGTGAGG[T/C]TTGTCCAGTGACAAGTTTATAGGATTTAAGATTTACAAAATTAAGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Nonsense 246 657 6 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 250 477 6 10
ENSDART00000017932 Nonsense 246 657 6 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 250 477 6 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 13511504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCTAAACCTGCCACCAGGCTTATGTGGAAATCACAGTATGTGCCCTA[C/A]GATGGCATTCCCTTCGTTAATGCAGGTAATCTGGTATGACTGTTATGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Nonsense 246 657 6 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 250 477 6 10
ENSDART00000017932 Nonsense 246 657 6 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 250 477 6 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 13511504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCTAAACCTGCCACCAGGCTYATGTGGAAATCACAGTATGTGCCCTA[C/A]GATGGCATTCCCTTCGTTAATGCAGGTAATCTGGTATGACTGTTATGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Nonsense 390 657 9 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 394 477 9 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 13515190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACWGAAGACCATCCTCATGAAGAGGAAGACACAGAAGAGCTGGGGTTT[C/T]AAGCCATGCAGGACGTCCTTGTGGAGGATGGGGTATCCCTACCCGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Nonsense 633 657 13 14
ENSDART00000140269 Nonsense 138 162 3 4
ENSDART00000141705 None None 477 None 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 13522719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATKCTGGAGCTAATGGAGGAATCACACAGATCCTGCTGGAGGATGGA[C/T]AGGCTATYCCAGTCCAGATTGTGGAGCCGGCAAACATAGGTGAKTATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vdp5uuyl