ptprdb

Ensembl ID:
ENSDARG00000019945
ZFIN ID:
ZDB-GENE-070615-38
Description:
protein tyrosine phosphatase, receptor type, D isoform 2 [Source:RefSeq peptide;Acc:NP_001092239]
Human Orthologues:
PTPRD, PTPRS
Human Descriptions:
protein tyrosine phosphatase, receptor type, D [Source:HGNC Symbol;Acc:9668]
protein tyrosine phosphatase, receptor type, S [Source:HGNC Symbol;Acc:9681]
Mouse Orthologues:
Ptprd, Ptprs
Mouse Descriptions:
protein tyrosine phosphatase, receptor type, D Gene [Source:MGI Symbol;Acc:MGI:97812]
protein tyrosine phosphatase, receptor type, S Gene [Source:MGI Symbol;Acc:MGI:97815]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10181 Nonsense Available for shipment Available now
sa450 Essential Splice Site Confirmed mutation in F2 line During 2017
sa6579 Nonsense Mutation detected in F1 DNA During 2017
sa39591 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19469 Nonsense Available for shipment Available now
sa16499 Nonsense Available for shipment Available now
sa32646 Nonsense Mutation detected in F1 DNA During 2017
sa14902 Essential Splice Site Available for shipment Available now
sa32645 Nonsense Mutation detected in F1 DNA During 2017
sa19468 Essential Splice Site Available for shipment Available now
sa19467 Nonsense Available for shipment Available now
sa32644 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Nonsense 265 1869 5 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Nonsense 294 1934 7 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17935242)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18500410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGGCRAAATGTYCTGGAGCTCACCAACGYACGCCAGWCTGCCAACTA[C/A]ACGTGTGTCGCCATGTCTACACTCGGAGTTATAGAAACTGTTKCCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa450
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132   None 1869 None 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Essential Splice Site 770 1934 13 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17921516)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18486684
KASP Assay ID:
554-0377.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGCATCCTGGCATTCACTTTAATTTTTGTCTTGCTTTGTTTTTGTAA[G/A]CAGCCGCAGAATGACTCAATAGAACATGTGAGTATATCTTTTTTGAACAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa6579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Nonsense 899 1869 13 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Nonsense 961 1934 15 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17911843)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18477011
KASP Assay ID:
554-4812.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AMMTAACAGCCGAAAGCATCAACTCCTCATCTGCGATCCTGAGATGGGAG[C/T]GACCAAAAAACTATGACGGGATTCAAGRTTACCGCGTGTGGTTCGCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Essential Splice Site 973 1869 13 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Essential Splice Site 1035 1934 15 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17911617)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18476785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGCCCTATAGTCTCCCCATTTCCATCAAAACACAACCCGCAGAGGAAG[G/A]TAGGACACATGTGAATCCTCACACAAACAAAACAATTACTGTCAGGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Nonsense 990 1869 14 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Nonsense 1055 1934 16 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17911075)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18476243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAACTTCAAAGTGAAAGCTGCAATGAAGAGTTCAGTTCTGCTGACCTG[G/A]GAGTCTCGAACCACCAGTAATAAAGCGCAGTCTCTCATCGTAAGAACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Nonsense 1036 1869 15 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Nonsense 1101 1934 17 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17905976)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18471144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAGTTAGTGACTAAGCTAAAGCCTCARTCTCTGTACAACTTTCTRT[T/A]AACCAGTAAATCCGACAGCACTGGAGGCCTGCAGCACCGCACGGACGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Nonsense 1175 1869 17 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Nonsense 1240 1934 19 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17903800)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18468968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGGACATGTGTATGGAGCCTTCATGAACCGACCTCTGGTGAACGGA[C/T]AGGAGTATGTGTGCTTCGTACTGGCTATTCTCGAACTGGGCCAGAATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Essential Splice Site 1244 1869 18 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Essential Splice Site 1309 1934 20 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17901104)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18466272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCYGTCATCTTCATCATCAGCRTCGTCATCCTCATYCTCCTCTTTAAAAG[G/A]TGAGACAGACAAGAYAAATCAGCAGAAAGTGAGATTTAAWGAGTTRAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Nonsense 1318 1869 21 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Nonsense 1383 1934 23 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17894659)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18459827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATAGAGAGGATGAAGGCCAATGACAGCCTGAGGTTCTCTCAAGAGTA[T/G]GAGGTCAGATCTCTAAACACACACACACACATTCACACACACCAGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Essential Splice Site 1607 1869 27 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Essential Splice Site 1672 1934 29 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17872644)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18437812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATCTGTTCATTAAATGATACAGATGTTTGTGTGTGTGTCTCCTTTTC[A/T]GCGGTTAGCTAATGCCAAAGCGCATAACTCCAGATTCGTCAGTGCCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Nonsense 1753 1869 30 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Nonsense 1818 1934 32 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17869989)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18435157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGAAATGCTGATGTATCTTATTGGTTTTTCTCTCTCTTTAAGGATGGA[C/T]AATCCAGAACAGTCCGGCAGTTTCAGTTCACGGATTGGCCAGAGCAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089132 Nonsense 1790 1869 30 32
ENSDART00000127145   None 205 None 5
ENSDART00000131579 Nonsense 1855 1934 32 34
ENSDART00000143663   None 205 None 5
Genomic Location (Zv9):
Chromosome 1 (position 17869878)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18435046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCGAAGGGTTCATTGACTTCATTGGTCAAGTGCACAAAACAAAAGAA[C/T]AGTTCGGTCAGGATGGGCCAATCACAGTACACTGCAGGTGAGGAAAATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link