lft1

Ensembl ID:
ENSDARG00000019920
ZFIN ID:
ZDB-GENE-990630-10
Description:
lefty1 [Source:RefSeq peptide;Acc:NP_571035]
Human Orthologues:
LEFTY1, LEFTY2
Human Descriptions:
left-right determination factor 1 [Source:HGNC Symbol;Acc:6552]
left-right determination factor 2 [Source:HGNC Symbol;Acc:3122]
Mouse Orthologues:
Lefty1, Lefty2
Mouse Descriptions:
left right determination factor 1 Gene [Source:MGI Symbol;Acc:MGI:107405]
left-right determination factor 2 Gene [Source:MGI Symbol;Acc:MGI:2443573]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23761 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15195 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019196 Essential Splice Site 251 358 3 4
Genomic Location:
Chromosome 20 (position 35099898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGAAAACCAGAGCTGGTGCTTTACACACTCAACCTAGAGGAGTTTGG[G/A]TAAGCATGCCATTCAGAAATTGTTTCAGTCGTTTTTACCAATTGCTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019196 Essential Splice Site 251 358 4 4
Genomic Location:
Chromosome 20 (position 35099183)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARTGTATCCTMTATTTATCAGTGTGTTAAAATACATTTCCTTCACTTTGC[A/C]GGTCTAGYGGAGACTGTRAAAACAACAAAGACCGTGAAATGTGCTGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d2ee4rvq