dscc1

Ensembl ID:
ENSDARG00000019907
ZFIN ID:
ZDB-GENE-040912-35
Description:
Sister chromatid cohesion protein DCC1 [Source:UniProtKB/Swiss-Prot;Acc:Q66I84]
Human Orthologue:
DSCC1
Human Description:
defective in sister chromatid cohesion 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24453]
Mouse Orthologue:
Dscc1
Mouse Description:
defective in sister chromatid cohesion 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2876 Nonsense F2 line generated During 2017
sa36073 Nonsense Mutation detected in F1 DNA During 2017
sa32079 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2876
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012479 Nonsense 215 391 5 9
Genomic Location (Zv9):
Chromosome 16 (position 16874025)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14688886
KASP Assay ID:
554-3364.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATGAAGCTCTTGGGTCACGTGACGCAGCTGGTGGACTCAGAGTCTTG[G/A]TCTTTCAGCAAAGTTCCCCTCAGTGTCTGTTTGGAAGAGCTGGGGTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012479 Nonsense 226 391 5 9
Genomic Location (Zv9):
Chromosome 16 (position 16873993)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14688854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGACTCAGAGTCTTGGTCTTTCAGCAAAGTTCCCCTCAGTGTCTGTT[T/A]GGAAGAGCTGGGGTCCCTTGAGCCAAAGTGAGTTTTGATTGAGACTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012479 Nonsense 383 391 9 9
Genomic Location (Zv9):
Chromosome 16 (position 16867139)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14682000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGACAAAACATGCCCGTTCATCTATGCAAAATGGTATTAAAGTCTA[C/A]AATTCAAGAAGACCTGTAGCAACCTGAGATCACAAATATCATTGTAAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link