bsg

Ensembl ID:
ENSDARG00000019881
ZFIN ID:
ZDB-GENE-030131-9638
Description:
basigin [Source:RefSeq peptide;Acc:NP_937785]
Human Orthologue:
BSG
Human Description:
basigin (Ok blood group) [Source:HGNC Symbol;Acc:1116]
Mouse Orthologue:
Bsg
Mouse Description:
basigin Gene [Source:MGI Symbol;Acc:MGI:88208]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7493 Missense Mutation detected in F1 DNA During 2017
sa5689 Essential Splice Site F2 line generated During 2017
sa3178 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa7493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015951 Missense 81 404 2 9
ENSDART00000105392   None 287 None 8
ENSDART00000131131   None 262 None 8
Genomic Location (Zv9):
Chromosome 22 (position 19157701)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18908636
KASP Assay ID:
554-4094.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGATGAAATCATCACTCAGCTGTTTGATGGTGCAAGAGAGGATCGCG[T/A]TCACATCAACGCCACCTATATTGACCACGCCACCAGCTCGCTCATCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5689
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015951 Essential Splice Site 377 404 6 9
ENSDART00000105392 Essential Splice Site 260 287 5 8
ENSDART00000131131 Essential Splice Site 235 262 5 8
ENSDART00000015951 Essential Splice Site 377 404 6 9
ENSDART00000105392 Essential Splice Site 260 287 5 8
ENSDART00000131131 Essential Splice Site 235 262 5 8
Genomic Location (Zv9):
Chromosome 22 (position 19162989)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18913924
KASP Assay ID:
554-3076.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATCTTCGTCTACGAGAAGAGAAGAAAGCCTGATGAGATCAATGACGG[T/A]GCGTAACTCTTAACTGTTCGCGCCACAATGATTTCTCACTTACACTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3178
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015951 Essential Splice Site 377 404 6 9
ENSDART00000105392 Essential Splice Site 260 287 5 8
ENSDART00000131131 Essential Splice Site 235 262 5 8
ENSDART00000015951 Essential Splice Site 377 404 6 9
ENSDART00000105392 Essential Splice Site 260 287 5 8
ENSDART00000131131 Essential Splice Site 235 262 5 8
Genomic Location (Zv9):
Chromosome 22 (position 19162989)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18913924
KASP Assay ID:
554-3076.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATCTTCGTCTACGAGAAGAGAAGAAAGCCTGATGAGATCAATGACGG[T/A]GCGTAACTCTTAACTGTTCGCGCCACAATGATTTCTCACTTACACTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link