rbks

Ensembl ID:
ENSDARG00000019877
ZFIN ID:
ZDB-GENE-040625-112
Description:
ribokinase [Source:RefSeq peptide;Acc:NP_001002117]
Human Orthologue:
RBKS
Human Description:
ribokinase [Source:HGNC Symbol;Acc:30325]
Mouse Orthologue:
Rbks
Mouse Description:
ribokinase Gene [Source:MGI Symbol;Acc:MGI:1918586]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1915 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030622 Nonsense 141 311 6 9
Genomic Location (Zv9):
Chromosome 17 (position 41208908)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41094536
KASP Assay ID:
554-1905.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARCTACAACGGGCACAGTCTGCAATAATAAACGCCAAGGTGCTCGTTTGC[C/T]AGCTWGAAATCAGCYCTGATGCATCGCTACAGGCCCTAAAAATGGCTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link