fgl2

Ensembl ID:
ENSDARG00000019861
ZFIN ID:
ZDB-GENE-030131-9506
Description:
fibroleukin [Source:RefSeq peptide;Acc:NP_001020710]
Human Orthologue:
FGL2
Human Description:
fibrinogen-like 2 [Source:HGNC Symbol;Acc:3696]
Mouse Orthologue:
Fgl2
Mouse Description:
fibrinogen-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:103266]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14776 Nonsense Available for shipment Available now
sa15081 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022539 Nonsense 294 451 2 2
Genomic Location:
Chromosome 4 (position 19115993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGGGCTGACTACAAGAAGGGCTTCGGGAACCTTAACAGTGAATTCTG[G/A]CTTGGTAMTGATAAAATCCACCTGCTCACCAAAGCCAAGGACATGATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022539 Nonsense 323 451 2 2
Genomic Location:
Chromosome 4 (position 19115908)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGGACATGATCCTACGCATTGMGCTGGAAGACTCAGAGGGCACACGT[G/T]GATATGCCAAATATGATCAGTTCTATGTGTCCAATGAGTTCCTTCATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/87oqid3l