atp1a1b

Ensembl ID:
ENSDARG00000019856
ZFIN ID:
ZDB-GENE-001212-5
Description:
ATPase, Na+/K+ transporting, alpha 1b polypeptide [Source:RefSeq peptide;Acc:NP_571765]
Human Orthologue:
ATP1A1
Human Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide [Source:HGNC Symbol;Acc:799]
Mouse Orthologue:
Atp1a1
Mouse Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88105]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34699 Nonsense Mutation detected in F1 DNA During 2016
sa14431 Nonsense Available for shipment Available now
sa17012 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005086 Nonsense 90 1025 4 22
Genomic Location (Zv9):
Chromosome 9 (position 36959506)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36097395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCGTGATGGACCCAATGCTCTCACCCCCCCTCCAACCACCCCAGAAT[G/A]GGTCAAGTTCTGTAAGCAGATGTTTGGAGGTTTCTCCATGCTGTTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005086 Nonsense 989 1025 21 22
Genomic Location (Zv9):
Chromosome 9 (position 36972493)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36110382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTCTGCTTCTTTAGTTTACATTCTGCACTTTATCTACAGGCCCAACT[G/A]GTGGTTCTGTGCCTTCCCGTACYCTCTTCTCATCTTTATTTAKGATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005086 Nonsense 1003 1025 21 22
Genomic Location (Zv9):
Chromosome 9 (position 36972536)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36110425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAACTRGTGGTTCTGTGCCTTCCCGTACYCTCTTCTCATCTTTATTTA[T/G]GATGAAATGAGAAAGCTCATCCTTAGACGAAACCCAGGAGGTAATCARCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link