atp1a1b

Ensembl ID:
ENSDARG00000019856
ZFIN ID:
ZDB-GENE-001212-5
Description:
ATPase, Na+/K+ transporting, alpha 1b polypeptide [Source:RefSeq peptide;Acc:NP_571765]
Human Orthologue:
ATP1A1
Human Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide [Source:HGNC Symbol;Acc:799]
Mouse Orthologue:
Atp1a1
Mouse Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88105]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14431 Nonsense Available for shipment Available now
sa17012 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005086 Nonsense 989 1025 21 22
Genomic Location:
Chromosome 9 (position 36972493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTCTGCTTCTTTAGTTTACATTCTGCACTTTATCTACAGGCCCAACT[G/A]GTGGTTCTGTGCCTTCCCGTACYCTCTTCTCATCTTTATTTAKGATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005086 Nonsense 1003 1025 21 22
Genomic Location:
Chromosome 9 (position 36972536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAACTRGTGGTTCTGTGCCTTCCCGTACYCTCTTCTCATCTTTATTTA[T/G]GATGAAATGAGAAAGCTCATCCTTAGACGAAACCCAGGAGGTAATCARCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jksjwl8w