cnot3b

Ensembl ID:
ENSDARG00000019842
ZFIN ID:
ZDB-GENE-030131-5838
Description:
CCR4-NOT transcription complex, subunit 3b [Source:RefSeq peptide;Acc:NP_956134]
Human Orthologue:
CNOT3
Human Description:
CCR4-NOT transcription complex, subunit 3 [Source:HGNC Symbol;Acc:7879]
Mouse Orthologue:
Cnot3
Mouse Description:
CCR4-NOT transcription complex, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2385261]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23456 Nonsense Mutation detected in F1 DNA During 2014
sa23455 Essential Splice Site Available for shipment Available now
sa3043 Nonsense Mutation detected in F1 DNA During 2014
sa9040 Nonsense Mutation detected in F1 DNA During 2014
sa15689 Nonsense Available for shipment Available now
sa6547 Missense, Nonsense Mutation detected in F1 DNA During 2014
sa10327 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Nonsense 145 906 7 18
ENSDART00000081485 Nonsense 145 846 7 23
ENSDART00000136304 Nonsense 145 908 7 18
ENSDART00000136697 Nonsense 145 885 7 18
Genomic Location:
Chromosome 19 (position 10898812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGAACACAATAGACACATTGAATATGCAAGTGGACCAGTTTGAGAGC[G/T]AGGTTGAATCGCTTTCTGTCCAGACCAGGAAAAAGAAAGGCGACAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Essential Splice Site 234 906 8 18
ENSDART00000081485 Essential Splice Site 232 846 12 23
ENSDART00000136304 Essential Splice Site 234 908 8 18
ENSDART00000136697 Essential Splice Site 234 885 8 18
Genomic Location:
Chromosome 19 (position 10896454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAGGAGAACGAGTTCCTCTATGATGACCTTGATTTAGAGGAGATAC[G/T]TGAGTGCTTGAAAATGCTTGTCAGAAGGGAGTTTGTTTTTTTTTTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Nonsense 613 906 12 18
ENSDART00000081485 Nonsense 611 846 16 23
ENSDART00000136304 Nonsense 613 908 12 18
ENSDART00000136697 Nonsense 613 885 12 18
Genomic Location:
Chromosome 19 (position 10893115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGCCCTCAACAGTGCCAGCCAATCACAGAACAGCCAATCCTCAYCCT[T/G]AAATTTAGCTGTAACAAATCAGCTGTAAGTAATGGCTTGCTCAGAACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Nonsense 810 906 16 18
ENSDART00000081485 Nonsense 808 846 20 23
ENSDART00000136304 Nonsense 810 908 16 18
ENSDART00000136697 Nonsense 810 885 16 18
Genomic Location:
Chromosome 19 (position 10883197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTACCAGAGACTGTCTACCGAGACCCTGTTCTTCATCTTTTACTAYT[T/A]AGAGGTGTGTGTGCTWACAATTAATGCCCTCAATGAAGCCTCTGTAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Nonsense 817 906 17 18
ENSDART00000081485 Nonsense 815 846 21 23
ENSDART00000136304 Nonsense 817 908 17 18
ENSDART00000136697 Nonsense 817 885 17 18
Genomic Location:
Chromosome 19 (position 10882961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACTGACAAATAGTTTTTTTNNGCACTCCCAAGGGCACAAAAGCGCAGTA[T/A]CTAGCAGYCAAAGCCTTGAAAAAACAGTCATGGAGGTTTCACACAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 None None 906 None 18
ENSDART00000081485 Missense 835 846 22 23
ENSDART00000136304 None None 908 None 18
ENSDART00000136697 Nonsense 837 885 17 18
Genomic Location:
Chromosome 19 (position 10882901)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCCTTGAAAAAACAGTCATGGAGGTTTCACACAAAGTACATGATGTG[G/A]TTCCAGAGGCACGAGGAGCCCAAGACCATCACAGATGAGTTTGAACAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 None None 906 None 18
ENSDART00000081485 None None 846 23 23
ENSDART00000136304 None None 908 None 18
ENSDART00000136697 Nonsense 882 885 18 18
Genomic Location:
Chromosome 19 (position 10878352)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGAGGAAAAAGGAAGGATTTACGTTTGAGTACAGGYACCTGGAGGAC[C/T]GAGACCTTCAGTGACRGATGGTCAACTAGAAMRGAGAAGGACTACTGWCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ediigfxe