adra2b

Ensembl ID:
ENSDARG00000019819
ZFIN ID:
ZDB-GENE-021010-2
Description:
Alpha-2B adrenergic receptor [Source:UniProtKB/Swiss-Prot;Acc:Q90WY5]
Human Orthologue:
ADRA2B
Human Description:
adrenergic, alpha-2B-, receptor [Source:HGNC Symbol;Acc:282]
Mouse Orthologue:
Adra2b
Mouse Description:
adrenergic receptor, alpha 2b Gene [Source:MGI Symbol;Acc:MGI:87935]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7617 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018663 Missense 121 509 1 1
Genomic Location:
Chromosome 8 (position 42260215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTACTGGTATTTCCGCTCTGTATGGTGTGAGATCTACCTGGCGCTGG[A/T]TGTGTTGTTCTGCACTTCCTCCATAGTACATCTGTGYGCCATCAGTCTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n3a527hp