fn1

Ensembl ID:
ENSDARG00000019815
ZFIN ID:
ZDB-GENE-000426-1
Description:
fibronectin [Source:RefSeq peptide;Acc:NP_571595]
Human Orthologue:
FN1
Human Description:
fibronectin 1 [Source:HGNC Symbol;Acc:3778]
Mouse Orthologue:
Fn1
Mouse Description:
fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6112 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12585 Nonsense Available for shipment Available now
sa21453 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7625 Missense Mutation detected in F1 DNA During 2014
sa5529 Nonsense Mutation detected in F1 DNA During 2014
sa21452 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Essential Splice Site 43 2477 1 51
ENSDART00000124346 Essential Splice Site 43 2480 1 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 15700651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACATAAAAGACAAGCTCAGGAACACTCTGTATCATCTGTGTCACAAG[G/A]TAGGAGGCACTCTRTGTGTATTGGCTTTGGGTTTATTTCATTTATTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Nonsense 156 2477 4 51
ENSDART00000124346 Nonsense 156 2480 4 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 15698343)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTACAAGATTGGAGACAYATGGCAGAGACCTCATGACACTGGAGACTA[C/A]ATGCTGGAGTGTGTCTGCTTGGGAAATGGGAAGGGGGAGTGGACCTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Essential Splice Site 341 2477 None 51
ENSDART00000124346 Essential Splice Site 341 2480 None 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 15693775)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTTAGACTGAATGGTTTTTATCTAAGTTTCTTACTGTCTTTTGTGT[A/T]GAGAGTCAATCTCAGGTGTATGGCGGGACCTCAGGTGGCGAACCGTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Missense 356 2477 8 51
ENSDART00000124346 Missense 356 2480 8 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 15693729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAGAGAGTCAATCTCWGGTGTATGGCGGGACCTCAGGTGGCGAACCK[T/A]GTGCTTTCCCTTTTGTGTTCATGGGGAAAACGTTTTACTCCTGCACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Nonsense 594 2477 12 51
ENSDART00000124346 Nonsense 594 2480 12 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 15683097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGGAATCCACTACAGATGTTACTGCTATGGTAATGGCATCGGGGAGT[T/A]GAGCTGCGAGCCTCAGCATTCTATCTCTGGTGAGTAAACGGCATCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Nonsense 787 2477 16 51
ENSDART00000124346 Nonsense 787 2480 16 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 15675924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAACATCAGTGAACTTCTGCCAGGAAGGAAGTACACTGTGAATGTATA[T/A]GAAGTGACAGGAGAAGGAGAACCTAACCTCATCCTCACCACTTCCCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ufwyzhjf