fn1

Ensembl ID:
ENSDARG00000019815
ZFIN ID:
ZDB-GENE-000426-1
Description:
fibronectin [Source:RefSeq peptide;Acc:NP_571595]
Human Orthologue:
FN1
Human Description:
fibronectin 1 [Source:HGNC Symbol;Acc:3778]
Mouse Orthologue:
Fn1
Mouse Description:
fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6112 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12585 Nonsense Available for shipment Available now
sa34594 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21453 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7625 Missense Mutation detected in F1 DNA During 2016
sa21452 Nonsense Mutation detected in F1 DNA During 2016
sa34593 Essential Splice Site Mutation detected in F1 DNA During 2016
sa27367 Nonsense Mutation detected in F1 DNA During 2016
sa27366 Essential Splice Site Mutation detected in F1 DNA During 2016
sa27365 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Essential Splice Site 43 2477 1 51
ENSDART00000124346 Essential Splice Site 43 2480 1 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15700651)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15453216
KASP Assay ID:
554-3706.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACATAAAAGACAAGCTCAGGAACACTCTGTATCATCTGTGTCACAAG[G/A]TAGGAGGCACTCTRTGTGTATTGGCTTTGGGTTTATTTCATTTATTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Nonsense 156 2477 4 51
ENSDART00000124346 Nonsense 156 2480 4 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15698343)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15450908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTACAAGATTGGAGACAYATGGCAGAGACCTCATGACACTGGAGACTA[C/A]ATGCTGGAGTGTGTCTGCTTGGGAAATGGGAAGGGGGAGTGGACCTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Essential Splice Site 222 2477 None 51
ENSDART00000124346 Essential Splice Site 222 2480 None 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15695862)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15448427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACCTGCCTCGGAGAAGGAAGTGGACGTATTACATGCACATCCAGAAG[T/C]AAAAACTCCAGCTTTTTTTATAGAATAGTGCAACAGTCCAAACCTCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Essential Splice Site 341 2477 None 51
ENSDART00000124346 Essential Splice Site 341 2480 None 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15693775)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15446340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTTAGACTGAATGGTTTTTATCTAAGTTTCTTACTGTCTTTTGTGT[A/T]GAGAGTCAATCTCAGGTGTATGGCGGGACCTCAGGTGGCGAACCGTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Missense 356 2477 8 51
ENSDART00000124346 Missense 356 2480 8 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15693729)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15446294
KASP Assay ID:
554-4218.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAGAGAGTCAATCTCWGGTGTATGGCGGGACCTCAGGTGGCGAACCK[T/A]GTGCTTTCCCTTTTGTGTTCATGGGGAAAACGTTTTACTCCTGCACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Nonsense 787 2477 16 51
ENSDART00000124346 Nonsense 787 2480 16 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15675924)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15428489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAACATCAGTGAACTTCTGCCAGGAAGGAAGTACACTGTGAATGTATA[T/A]GAAGTGACAGGAGAAGGAGAACCTAACCTCATCCTCACCACTTCCCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Essential Splice Site 1170 2477 24 51
ENSDART00000124346 Essential Splice Site 1172 2480 22 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15663775)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15416340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGTGGTCAAGAGCATGGAAACCCTATAACTCGGCGCGTGGTCACTCG[T/A]AAGTCTAAAAAAAGTCCTTATCAAACAAAGGTTGTTGAAGCTGTGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Nonsense 1226 2477 26 51
ENSDART00000124346 Nonsense 1228 2480 24 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15662924)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15415489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCAAAGGCCAGCAGGGCAATTCACTTGAGGAGTTTGTGAAGGCCGGA[C/T]AGAACTCATGCACATTAGAGAACCTGAGTCCAGGAGTAGAGTACAATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Essential Splice Site 1448 2477 31 51
ENSDART00000124346 Essential Splice Site 1450 2480 28 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15656909)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15409474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTGCAACCTGTTATGTTGGTTAAAAAACTTGTTCATTTTGCTTCTCA[G/A]TTTTTGATGCCCCTGTTGGCCTTCAGTTCTCTGATGTGGGCACCACCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010521 Nonsense 2349 2477 48 51
ENSDART00000124346 Nonsense 2352 2480 43 46

The following transcripts of ENSDARG00000019815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 15641731)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15394296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGCATCTCTCAATCTGTAGAATGGTGCCATGACAGTGGCCACAACTAC[C/T]GAATCGGTGAGAAATGGGACCGGCGTGCTGAGAACGGCCACATGATGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link