si:ch211-157f15.1

Ensembl ID:
ENSDARG00000019808
ZFIN ID:
ZDB-GENE-030829-19
Description:
envoplakin [Source:RefSeq peptide;Acc:NP_001112369]
Human Orthologues:
EVPL, EVPLL
Human Descriptions:
envoplakin [Source:HGNC Symbol;Acc:3503]
envoplakin-like [Source:HGNC Symbol;Acc:35236]
Mouse Orthologue:
Evpl
Mouse Description:
envoplakin Gene [Source:MGI Symbol;Acc:MGI:107507]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33854 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18630 Essential Splice Site Available for shipment Available now
sa1564 Essential Splice Site F2 line generated During 2017
sa33855 Nonsense Mutation detected in F1 DNA During 2017
sa33856 Nonsense Mutation detected in F1 DNA During 2017
sa33857 Nonsense Mutation detected in F1 DNA During 2017
sa2283 Nonsense F2 line generated During 2017
sa33858 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Essential Splice Site 18 1975 2 22
ENSDART00000130497   None 630 None 2
ENSDART00000143263 Essential Splice Site 18 1961 2 21
Genomic Location (Zv9):
Chromosome 6 (position 21645011)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17960785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCACTGATCATCCAAACATCATAAAATTGTTTAACTTTTAAATTTGAC[A/T]GAACACAGGTGAGCAATCTGGCCTTGCTGATTGCACGTATGCAGAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Essential Splice Site 51 1975 2 22
ENSDART00000130497   None 630 None 2
ENSDART00000143263 Essential Splice Site 51 1961 2 21
Genomic Location (Zv9):
Chromosome 6 (position 21645113)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17960887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACACTRTTGAGAAAGATGTACTGCGYGCAGAAGAGCTGCTGCTCCTT[G/A]TAAGAAGCACTTCATTTTTTATAAGCATGATATATTACYAGTACTACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1564
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Essential Splice Site 144 1975 4 22
ENSDART00000130497   None 630 None 2
ENSDART00000143263 Essential Splice Site 144 1961 4 21
Genomic Location (Zv9):
Chromosome 6 (position 21645941)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17961715
KASP Assay ID:
554-1507.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAACTTCAACCAAGAATTAACTGGGCTYTGGTACTAAACCAAAAACAG[G/A]TGTGAATACACATTCAATATATTGATTTACTTTTGTATACATTATCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 611 1975 15 22
ENSDART00000130497   None 630 None 2
ENSDART00000143263 Nonsense 597 1961 14 21
Genomic Location (Zv9):
Chromosome 6 (position 21659185)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17974959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTAAAAACAAACAGGACAGTCTAGTTGCTCTGAACAGTCTCTACAAA[A/T]AGAAGTATGTAAACTTACAAAAGTGATTATAAAAGGTAATTAAAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 695 1975 17 22
ENSDART00000130497   None 630 None 2
ENSDART00000143263 Nonsense 681 1961 16 21
Genomic Location (Zv9):
Chromosome 6 (position 21660032)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17975806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCACTTAAGAAGCTATGCAGTTCACTTCAGCAGGGTTACCAAGAATA[C/A]TGCCCTGATATACGCAGACAGGAAGCAGAAGTGAAGAATCTTCAAAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 1061 1975 22 22
ENSDART00000130497   None 630 None 2
ENSDART00000143263 Nonsense 1047 1961 21 21
Genomic Location (Zv9):
Chromosome 6 (position 21663444)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17979218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCAAAACATAAAAGAGAAGGTGGTGCAAAAGGAAGTGGTTAGACTT[G/T]AAAAAGATCCAGAAATGTTAAAAGCAGTTAGGACATTTGAGTTGGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2283
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 1593 1975 22 22
ENSDART00000130497 Nonsense 330 630 1 2
ENSDART00000143263 Nonsense 1579 1961 21 21
Genomic Location (Zv9):
Chromosome 6 (position 21665040)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17980814
KASP Assay ID:
554-2507.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGAGATCWTTGGAATCTGAAAGACAAAACATCACCATCTCCTTCCAA[C/T]AGCATTCTAGGCTGATGAGTGAAAGAAAYCAAATGAACAGGCAAAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 1741 1975 22 22
ENSDART00000130497 Nonsense 478 630 1 2
ENSDART00000143263 Nonsense 1727 1961 21 21
Genomic Location (Zv9):
Chromosome 6 (position 21665484)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17981258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCATCAAAACTGCACTAAAAGAAGGCAAGGTGACCAAATACCAACTA[C/T]AACAGTATAAGGATGGCAAAATGTCTATTTCAGAGTTTGCTCTTCTTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link