PACS1 (1 of 3)

Ensembl ID:
ENSDARG00000019800
Description:
phosphofurin acidic cluster sorting protein 1 [Source:HGNC Symbol;Acc:30032]
Human Orthologue:
PACS1
Human Description:
phosphofurin acidic cluster sorting protein 1 [Source:HGNC Symbol;Acc:30032]
Mouse Orthologue:
Pacs1
Mouse Description:
phosphofurin acidic cluster sorting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277113]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16934 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129818 Essential Splice Site 202 241 6 7
Genomic Location (Zv9):
Chromosome 7 (position 7761403)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150435.1 114120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAGTCGGCTCATCTGTTCGGCCAAACAGCAGCAGACCATCCYGAAAG[G/A]TAYATTACAGCCAGAAATCTACCACWATGTCAGCTAAACCAGTRTTTCCM
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link