A4QP95_DANRE

Ensembl ID:
ENSDARG00000019772
Description:
LOC563828 protein [Source:UniProtKB/TrEMBL;Acc:A4QP95]
Human Orthologue:
C2
Human Description:
complement component 2 [Source:HGNC Symbol;Acc:1248]
Mouse Orthologue:
C2
Mouse Description:
complement component 2 (within H-2S) Gene [Source:MGI Symbol;Acc:MGI:88226]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4582 Nonsense Mutation detected in F1 DNA During 2014
sa22560 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018062 Nonsense 281 835 5 19
Genomic Location:
Chromosome 15 (position 481986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTACCTATGTCAGTCAGRCCTGGATATTCTGGGCTCTCCTGAAAGATG[G/A]TGTTTGGATTCAAGGGAATGGAGTGGTGCAGAACCCCGCTGCTACGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018062 Essential Splice Site 465 835 9 19
Genomic Location:
Chromosome 15 (position 484395)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGTCATTTCAATGAGACTCAGAACATCCTCATCATAGCAACTGACGG[T/C]AAGAGGCTATCACTGAACTCTGCGTCTGGAGGACACACATTTACAAATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fmn2dg7k