A4QP95_DANRE

Ensembl ID:
ENSDARG00000019772
Description:
LOC563828 protein [Source:UniProtKB/TrEMBL;Acc:A4QP95]
Human Orthologue:
C2
Human Description:
complement component 2 [Source:HGNC Symbol;Acc:1248]
Mouse Orthologue:
C2
Mouse Description:
complement component 2 (within H-2S) Gene [Source:MGI Symbol;Acc:MGI:88226]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35771 Nonsense Mutation detected in F1 DNA During 2016
sa4582 Nonsense Mutation detected in F1 DNA During 2016
sa22560 Essential Splice Site Available for shipment Available now
sa39016 Nonsense Mutation detected in F1 DNA During 2016
sa35772 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018062 Nonsense 252 835 5 19
Genomic Location:
Chromosome 15 (position 481897)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCGTTTCCAGCGGAGGACTGCAGAGATCCAGGAATCCCTCCAGGAGCT[A/T]AACGCTTTGGGCATCATTTCCGCATTGGAGATAAAGTGCGGTACCTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018062 Nonsense 281 835 5 19
Genomic Location:
Chromosome 15 (position 481986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTACCTATGTCAGTCAGRCCTGGATATTCTGGGCTCTCCTGAAAGATG[G/A]TGTTTGGATTCAAGGGAATGGAGTGGTGCAGAACCCCGCTGCTACGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018062 Essential Splice Site 465 835 9 19
Genomic Location:
Chromosome 15 (position 484395)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGTCATTTCAATGAGACTCAGAACATCCTCATCATAGCAACTGACGG[T/C]AAGAGGCTATCACTGAACTCTGCGTCTGGAGGACACACATTTACAAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018062 Nonsense 474 835 10 19
Genomic Location:
Chromosome 15 (position 484862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTGTTTTTCTGTATCTCCAGGACACTCCAATATGGGACCCAACCCA[C/T]AAATCATGCTGAATAAAATCCGGAGCTTGCTCGGCTACAAACCCAGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018062 Essential Splice Site 546 835 12 19
Genomic Location:
Chromosome 15 (position 489032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCACCTCTGTGTGTGATTTCTAAAGTGTGAACTTGCTGTGTTTCTC[A/T]GGTGATTCTGCCGTGACCAAGTGTGGAATAGCTCAGGAGGAGCAGAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link