acp5a

Ensembl ID:
ENSDARG00000019763
ZFIN ID:
ZDB-GENE-040426-2864
Description:
tartrate-resistant acid phosphatase type 5 [Source:RefSeq peptide;Acc:NP_999938]
Human Orthologue:
ACP5
Human Description:
acid phosphatase 5, tartrate resistant [Source:HGNC Symbol;Acc:124]
Mouse Orthologue:
Acp5
Mouse Description:
acid phosphatase 5, tartrate resistant Gene [Source:MGI Symbol;Acc:MGI:87883]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17411 Nonsense Available for shipment Available now
sa40635 Nonsense Mutation detected in F1 DNA During 2016
sa16094 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004716 Nonsense 20 339 2 6
ENSDART00000135810 Nonsense 20 192 2 5
ENSDART00000142752 Nonsense 37 219 2 5

The following transcripts of ENSDARG00000019763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9435482)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8125180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTAATGCTGGTRTTTTTAAGTGCTCTCCCTGGGGTCCTTTGCTACTA[T/A]TCCTCATTCGTTGACCTGGAAGCTCAAGGAAGTGAGTTGCTATTGATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004716 Nonsense 240 339 5 6
ENSDART00000135810   None 192 None 5
ENSDART00000142752   None 219 None 5

The following transcripts of ENSDARG00000019763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9438869)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8121793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCAACTGACTGCCTGCTGAAGAATTTGAGGCCATTACTAAAGAAGTA[C/A]AAGGCCACGGCTTACCTTTGTGGCCATGATCACAACCTACAAGTACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004716 Essential Splice Site 254 339 None 6
ENSDART00000135810   None 192 None 5
ENSDART00000142752   None 219 None 5

The following transcripts of ENSDARG00000019763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9438913)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8121749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTACAAGGCCAYGGCTTACCTTTGTGGCCATGATCACAACCTACAAG[T/A]ACGTCTCTAAAGGAANCCKCTCTTTTGAAGCGATCTCCGTTAAATMATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link