rfng

Ensembl ID:
ENSDARG00000019746
ZFIN ID:
ZDB-GENE-030131-5418
Description:
Beta-1,3-N-acetylglucosaminyltransferase radical fringe [Source:UniProtKB/Swiss-Prot;Acc:Q6KFX9]
Human Orthologue:
RFNG
Human Description:
RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:9974]
Mouse Orthologue:
Rfng
Mouse Description:
RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Gene [Source:MGI Symbol;Acc:MGI:894275]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41933 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002867 Nonsense 187 362 5 10
ENSDART00000106665 Nonsense 187 362 5 10
ENSDART00000126315 Nonsense 187 362 5 9
Genomic Location (Zv9):
Chromosome 12 (position 3657798)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3031318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTCTGATGTTTTTCAGGTGGTTTTGTCATGTGGATGATGATAACTA[T/A]GTGATCCTGCCCAGTCTACTGGAGCTTCTGTCCTCGTACTCTCACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link