tlr4ba

Ensembl ID:
ENSDARG00000019742
ZFIN ID:
ZDB-GENE-040219-8
Description:
toll-like receptor 4b, duplicate a [Source:RefSeq peptide;Acc:NP_001124523]
Human Orthologue:
TLR4
Human Description:
toll-like receptor 4 [Source:HGNC Symbol;Acc:11850]
Mouse Orthologue:
Tlr4
Mouse Description:
toll-like receptor 4 Gene [Source:MGI Symbol;Acc:MGI:96824]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15344 Nonsense Available for shipment Available now
sa22268 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044697 Nonsense 290 750 1 1
ENSDART00000124036 Nonsense 327 787 2 2
Genomic Location:
Chromosome 13 (position 18565009)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACATTAGAAAAACTGGAAATTACACACAACAGTGAACCTATTTTTGCA[G/T]AGCCCTTYACAGAYCTGCCTAAACYGCAGTATGTAGATTTAAGTGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044697 Nonsense 613 750 1 1
ENSDART00000124036 Nonsense 650 787 2 2
Genomic Location:
Chromosome 13 (position 18565980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGACAGCAAGAATGTTCTTATGACGCATTTGTGATATTCTCCAGCTA[T/A]GATGAAGCTTGGGTCATGAATGAACTGATGGAGAATTTGGAGAACGGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nbmip7f1