im:7162084

Ensembl ID:
ENSDARG00000019741
ZFIN ID:
ZDB-GENE-080917-47
Description:
hypothetical protein LOC567411 [Source:RefSeq peptide;Acc:NP_001165869]
Human Orthologue:
CCND1
Human Description:
cyclin D1 [Source:HGNC Symbol;Acc:1582]
Mouse Orthologue:
Ccnd1
Mouse Description:
cyclin D1 Gene [Source:MGI Symbol;Acc:MGI:88313]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40082 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103502 Nonsense 273 323 3 4
Genomic Location (Zv9):
Chromosome 3 (position 30307056)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30025095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCGCGGGAGAGATGAGCCTCATGACCGCTGCCCTCGCCACACTCTGC[C/T]AGACAGATGTGGTAAGCTCTACTGCATCGATGAAGAATGTCGGGCCGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: Genome-wide association study identifies five new breast cancer susceptibility loci. (View Study)
  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link