bmpr1aa

Ensembl ID:
ENSDARG00000019728
ZFIN ID:
ZDB-GENE-000502-1
Description:
bone morphogenetic protein receptor, type 1a [Source:RefSeq peptide;Acc:NP_571696]
Human Orthologue:
BMPR1A
Human Description:
bone morphogenetic protein receptor, type IA [Source:HGNC Symbol;Acc:1076]
Mouse Orthologue:
Bmpr1a
Mouse Description:
bone morphogenetic protein receptor, type 1A Gene [Source:MGI Symbol;Acc:MGI:1338938]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8457 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026768 Essential Splice Site 77 527 None 13

The following transcripts of ENSDARG00000019728 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 22753525)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22482863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACTGCTCAGGACATTGCCCCGATGATGCCAAGAACAATACCTGCGAG[T/C]GAGGGCCACATGCACCTTTTAAATGATCAAGATTGTGCTTTCTAAAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link