celsr2l

Ensembl ID:
ENSDARG00000019726
ZFIN ID:
ZDB-GENE-050208-404
Description:
cadherin EGF LAG seven-pass G-type receptor 2 [Source:RefSeq peptide;Acc:NP_001074046]
Human Orthologues:
CELSR1, CELSR2, CELSR3
Human Descriptions:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologues:
Celsr1, Celsr2, Celsr3
Mouse Descriptions:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24043 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082453 Nonsense 166 1478 4 29
ENSDART00000136491 Nonsense 167 1272 4 25
Genomic Location:
Chromosome 22 (position 416671)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGCTGCATGAAGGACCTGCGCATTGACGAGCGGCACGTCGACATGGCC[G/T]GATTCATCGCTAATAACGGAACGCTACCCGGTGAGCTGTCGCTTGCAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gnq6l2mx