metap1d

Ensembl ID:
ENSDARG00000019715
ZFIN ID:
ZDB-GENE-050522-71
Description:
Methionine aminopeptidase 1D, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q4VBS4]
Human Orthologue:
METAP1D
Human Description:
methionyl aminopeptidase type 1D (mitochondrial) [Source:HGNC Symbol;Acc:32583]
Mouse Orthologue:
Metap1d
Mouse Description:
methionyl aminopeptidase type 1D (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:1913809]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39628 Nonsense Mutation detected in F1 DNA During 2016
sa38270 Nonsense Mutation detected in F1 DNA During 2016
sa19517 Essential Splice Site Available for shipment Available now
sa39629 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022841 Nonsense 95 338 3 10
Genomic Location (Zv9):
Chromosome 1 (position 30012433)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30152245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCAGCAAAGTGCCTGAATGGCCAGATTACATTGAGATTAAAGATGAA[G/T]AGCAGATCCAGGGATTAAGACGAGCGTGTCAACTAGCCAGACACATACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022841 Nonsense 153 338 4 10
Genomic Location (Zv9):
Chromosome 1 (position 30012720)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30152532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCACAATGGCTACCCTTCTCCCTTACATTATGGGGGCTTTCCGAAGT[C/A]GGTCTGTACCTCTGTGAACAATGTTGTATGTCACGGCATTCCAGACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022841 Essential Splice Site 169 338 4 10
Genomic Location (Zv9):
Chromosome 1 (position 30012770)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30152582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCTGTACCTCTGTGAACAATGTTGTATGTCACGGCATTCCAGACAGG[T/G]AACTCAGTGCTATTAAACATAAGTGCTTTGTTTTGACTGAATCTGTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022841 Nonsense 336 338 10 10
Genomic Location (Zv9):
Chromosome 1 (position 30030328)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30170140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGGTTGTCATCACTAGCGATGGTGTAGAGATTCTGACTAAGCTACCT[G/T]AGGAAGATTGACAGGAATGACGGGACATCTTGTGACGTGTGAGATGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link