metap1d

Ensembl ID:
ENSDARG00000019715
ZFIN ID:
ZDB-GENE-050522-71
Description:
Methionine aminopeptidase 1D, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q4VBS4]
Human Orthologue:
METAP1D
Human Description:
methionyl aminopeptidase type 1D (mitochondrial) [Source:HGNC Symbol;Acc:32583]
Mouse Orthologue:
Metap1d
Mouse Description:
methionyl aminopeptidase type 1D (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:1913809]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19517 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022841 Essential Splice Site 169 338 4 10
Genomic Location:
Chromosome 1 (position 30012770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCTGTACCTCTGTGAACAATGTTGTATGTCACGGCATTCCAGACAGG[T/G]AACTCAGTGCTATTAAACATAAGTGCTTTGTTTTGACTGAATCTGTATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1zn4jb6l